Your English writing platform
Discover LudwigSimilar(60)
In fact, the S.E.C. said, PrimeGen was "a pure scam" whose headquarters was "a rented mailbox in a U.P.S. Store opened with do-not-forward instructions".
Errorless learning is a teaching technique using feed-forward instruction, in order to prevent people from making mistakes during the learning process.
If you want to forward the same port to another computer, you need to delete the forwarding instruction or "rule" from the router first.
The software was designed such that a forward movement instruction moved the robot 50 cm forward, while a right or left instruction turned it 30^.
Here we meet a paradox: the person to carry forward the instruction delivered by a vast democratic exercise will be chosen by around 150,000 Conservative party members from a shortlist drafted by 330 Tory MPs.
After connecting, move forward with instruction.
PWO polymerase (Roche) was used with the following oligonucleotides in PCR reactions as per manufacturers instructions: Forward, 5'-CCGGGCACTGCTGCGTTCCTGCTCAG-3'; Reverse, 5'-GTCCTGAGCAGGAACGCAGCAGTGC-3'.
NRP1 open reading frames were subcloned into the pENTR/D-TOPO vector by PCR amplification with primers designed according to the manufacturer's instructions (forward, 5′-CACCATGGAGAGGGGGCTGCC-3′; reverse, 5′-TCATGCCTCCGAATAAGTACTCTGTG-3′) using TOPO cloning (Invitrogen).
PRELI/LEA− Tg embryo tail or resorption site DNA was prepared by standard methods and amplified with an Accuprime polymerase kit (Invitrogen) according to the manufacturer's instructions; forward SR- α promoter primer 5′CGCCCAGTTCCGCCCATTCT3′ and reverse PRELI/LEA−-6X His primer 5′TGTGTCTAGATCAGTGGTGGTGGTGGTGGTGGAGCTGCCGCTGCTGCTG3′ were used for the procedures.
In his report, compiled with Professor Linda Woodhead of Lancaster University, the argument is put forward that religious instruction should be left to Sunday schools and the like, while religious education takes on a wider moral theme.
In order to implement partial reconfiguration of logic resources, this paper puts forward dynamic reconfiguration instruction-DRP, and designs the JTAG circuit of accomplishing dynamic reconfiguration.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com