Sentence examples for forward ends from inspiring English sources

8.09pm GMT Great save from Petr Cech! Basel are attacking with intent and numbers against Chelsea, and their latest foray forward ends with Salah's shot hitting the ground and very nearly bouncing over Cech, who flings out a fist and pushes the ball wide.

In some annelids the forward end of the upper blood vessel is enlarged with muscles to form a heart, while in the forward ends of many earthworms some of the vessels that connect the upper and lower main vessels function as hearts.

Their 5′ forward ends were labeled with M13 fluorescence (5′-CACGACGTTGTAAAACGAC-3′).

The assembled SpPKC1 sequence was used to design the following primers: GTGGATAATTTTTGCTGGATTTGCGCCTTGA, (forward; ends 13 bp upstream of start codon) and GTTCTACAGACAGACTGGCA CTAGCT (reverse; reverse complement of stop codon underlined).

The module had a docking port at each end and four ports sited radially at its forward end.

One tube is open at the forward end; the opening is referred to as the dynamic-pressure orifice.

Mao's Great Leap Forward ended in the worst famine in history, killing between thirty and forty-five million people.

These can reach a length of 24cm and, in courtship, are tilted forward, ending up almost vertically erect.

After a motile period, the planula attaches by its forward end to a solid object and develops tentacles around its posterior end, thereby transforming into a polyp.

The forward end is open, but the aft end has a heavy grill of round steel bars that is designed to retain large rock samples.

The posterior end of the pouchlike median vagina is separated from the forward end of the urinogenital sinus by a partition.