Sentence examples for forward below from inspiring English sources

As Rivera was announced and his "Enter Sandman" theme began, a bullpen camera smoothly caught Rivera walking forward, below, and away in one shot.

It's two speakers facing forward below the screen easily fill a room.

Look carefully at the replay and you could see the point at which his shin snapped forward below the knee.

It was situated below the ear, extending forward below the cheek, and down upon the side of the neck, so as nearly to touch the clavicle.

The door, whose location on the jumbo jet was forward below the passenger cabin, is 10 feet wide and 9 feet high and weighs close to 1,000 pounds.

The results show that existence of imbalance and shaft bow causes the synchronous forced precession of the rotor to be forward (below the first value of split balance resonance and above the second value of the split balance resonance) or backward (between the two values of the split resonance).

Further, we put forward the below formula to compute the importance after combining Gaussian kernels.

Check out a photo of the Forward Osmosis Bag (below).

The beta-actin gene was used as an internal reference, and primers were designed as below, forward primer: 5′- TGCAAAGCCGGATTCGCTGG -3′; reverse primer: 5′- AGTTGGTGACAATACCGTGC -3′.

"This can't happen," said Iowa forward Greg Brunner, below.

One more attraction is the price: North Fork trades at 12-times forward earnings, below the regional-bank average.