Sentence examples for form was amplified from inspiring English sources

The SAP-less form was amplified using primer 6 and CACCATGAGAGCTGAAGGGCTCGACCC.

A 1452 bp DNA fragment corresponding to this truncated form, was amplified from genomic DNA of BY4742 strain using primers SM28 and SM29, digested with endonucleases BamHI and NotI and cloned into BamHI/NotI digested plasmid pUC57-delta1_2-ADHpr-PHO8-CYCt-kanMX.

Therefore only the normal form is amplified by RT-PCR using this primer (Fig. 6, left part).

The conventional forms were amplified with primers complementary to chromosomal sequences adjacent to the integration site.

The difficulties of defining names for peptides and their fragments or modified forms are amplified when they associate with other biological molecules in the cell to form complexes, or when an annotator organizes groups of molecules with shared features into sets.

The 3' flanking region of the Aaku80 gene, which formed DRs, was amplified from A. aculeatus genomic DNA using the primer pair aku80CF1 and aku80CR1.

The expected 153-bp fragment encoding the mature form of PgD5 was amplified with the primer set mPgD5FWD (5'-CGGATGTGTGAGTCGCAGA-3') and mPGD5rev (5'-TTAACAGGGTTTCTCGCAGA-3').

The cDNA for MsrB1 corresponding to Form 2 3'-UTR was amplified from a mouse EST clone (IMAGE: 6432555, Open Biosystems, Huntsville, AL).

MEL-18 and RYBP full-length cDNA fused to a C-terminal 2xFlag was amplified form pCBA-2xFlag vector using universal forward (CTCGAGGCGAGAGAGGATCCACCATG) and reverse (GCGGCCGCCTTTCACTTATCGTCGTCATCCTT) primers and cloned into pCAG vector (Elderkin et al., 2007 ).

The unmethylated form of the same sequence was amplified using the primers: F2unmeth 5'-TTGTGGGTTATAGGTGTAGAGT-3' at -93 nucleotide from translation start site and R2unmeth 5'-CCAAACACACACATAATAATAAA-3' at +141 (amplicon length of 258 bp).

The open reading form of the rol gene was amplified directly from R. oryzae XY1 genomic DNA using a pair of primers, ROL-F1 (CCG ATGGTTTCATTCATTTCCA) and ROLR1 (GC TTACAAACAGCTTCCTTCG) according to the sequence of the lipase from R. oryzae (GenBank accession no. AF229435).