A phrase reinforcement learning has been proposed in [145] where a starting phrase represents the topic for which generating a summary of tweets has been proposed, and this best partial summary represents the selection of path with the maximum sum of weights along the path [145].
It also did substantial investment banking work for Enron, which generated fees for the firm.
Datawind has sponsored an applications contest for students, which generated a point-of-sale system for street vendors, who make $100 a month or less.
He produced and played on the hit albums "Just as I Am" for Bill Withers, which generated the standard "Ain't No Sunshine," and "Stardust" for Willie Nelson.
A recovery in spending by local advertisers is crucial for Viacom, which generated nearly 46percentt of its revenue from advertising in the first six months of this year.
Over the years, Amazon has been the target of several such campaigns, notably a 2014 UK Christmas petition by watchdog group Amazon Anonymous to demand fair wages for employees which generated over 135,000 signatures and is still ongoing.
Apparently not too big a problem for Canon, which generated revenues worth $35 billion in fiscal 2009.
Primer sequences were: 5'-AGTCAGCGCACGATCACTGTC-3' (forward) and 5'-GACGCGCAGGATGTTGATGTC-3' (reverse) for GADD45α, which generated a 183-bp fragment; 5'-ACATGAGCCACGGGAAGGGAAC-3' (forward) and 5'-ATGCGAATGCAGCGGTAGCC-3' (reverse) for BTG2, which generated a 211-bp fragment.
The primers were prdap35: agctcagggagtacttcaaga and prdap24 :ggagcttgattcttgctgtcc for Dazap1 which generated a product of 211 bp, and prdaz71: atcgaactggtgtgtcgaagg and prdaz72: ggaggctgcatgtaagtctca for Dazl1 which generated a product of 245 bp.
