Exact(6)
Primer sequences used were as described and published on the MLST website (www.mlst.net), except for the recA and mutS alleles for which adjusted primers were designed with the following sequences; ssrecA-f: ATAGCCACGTTGGTTTGCAG, ssrecA-r: CATAATGAACACGTATCTTGCGG; ssmutS-f GAGCAGATGGAAGATCCTAAGC, ssmutS-r ACAAACTACCATGCTTCTTGCC. MLST results were analyzed using eBURST (www.mlst.net) [13].
The adjusted R2 values were highest for utilization of skilled birth attendants (0.60) and caesarean section (0.57), indicating that our set of independent variables explained much more of the variability in these two service coverage rates than the others, for which adjusted R2 values ranged from 0.03 to 0.39 in the models with separate values for doctors and nurses.
Table S1 lists taxa that either had no original values (coded as indifferent by Ellenberg et al. [44]) and to which we assigned indicator values or for which adjusted values differed from original values.
†Multiple logistic regression using backward elimination approach and controlling for the effect of all variables for which adjusted estimates are shown.
In six studies for which adjusted ORs of CI-AKI in the elderly were reported, the pooled OR of CI-AKI in the elderly was 2.55 (95% CI 1.85 3.52, I =0.34, Figure 3B).
Three regression models were developed, corresponding to rural areas, urban areas, and the entire population, for which adjusted odds ratios (aOR), 95% confidence intervals (95% CI), and p-values were reported.
Similar(54)
In the present study the effect of event was corrected for, which adjusts for the present veterinary and time differences.
For diabetes-predicting depression, the least-adjusted pooled RR was 1.20 (1.06–1.36) and the most-adjusted (only two of which adjusted for adiposity) RR was 1.09 (1.09–1.09).
For studies of depression predicting diabetes, the least-adjusted RR was 1.61 (95% CI 1.38 1.88), and the most-adjusted (all 13 of which adjusted for adiposity) RR was 1.40 (1.40–1.40).
To test for a linear increase (or decrease) in the odds ratios (OR) across the quartiles of FEV1, we used a chi-square test for trend, which adjusted for age, BMI and pack-years of smoking.
The researchers also measured adolescent food intake for the study which adjusted for factors such as age, height, weight, race, family history of breast cancer, history of benign breast disease, and smoking.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com