for the reactivated

USAGE SUMMARY

The phrase "for the reactivated" is grammatically correct and can be used in written English.
It can be used in contexts where you are referring to something that has been reactivated, such as a service, account, or system. Example: "The new features will be available for the reactivated users starting next week."

✓ Grammatically correct

Science

News & Media

Wiki

Human-verified examples from authoritative sources

Exact Expressions

4 human-written examples

Because, however strenuously they deny it, there is much of Factory's myth-making about them, while Bramley worked for the reactivated Factory Too in the 90s.

The Guardian - Music

As a result of hazard assessment for the reactivated landslide of the study area, it can be inferred that the deep-seated (about 15 – 35 m) clayey layers are the slip surface and the trigger for the movement.

International Journal of Geo-Engineering

Active expansion was evident for the reactivated memory OT-I cells between one to seven days following adoptive transfer, as reflected by an increased frequency of Thy1.1 cells in the regressing primary tumors, DLN and spleen, as well as an increased/sustained total number of Thy1.1 cells in the DLN and spleen (Fig. 3A).

Plosone

For the reactivated colitis, 42 days after the first intracolon TNBS instillation, 10 mg/kg TNBS was administered subcutaneously twice daily for three consecutive days.

Clinical and Translational Gastroenterology

Human-verified similar examples from authoritative sources

Similar Expressions

56 human-written examples

Prednisolone was used for the anti-inflammatory effect and valaciclovir for suppression of the reactivated VZV.

BMC Ophthalmology

Correct gene targeting was confirmed by Southern blotting or RT-PCR for expression of the reactivated Hprt using human_ HPRT_exon1_forward CAGGCGAACCTCTCGGCTTT and mouse_ Hprt_exon3_reverse GTGATGGCCTCCCATCTCCTT primers.

Biology Open

Our data suggest that memorizing the complex novel story claimed a considerable part of participants' limited cognitive processing capacities, leaving less cognitive resources for the reconsolidation of the reactivated memory.

Plosone

To distinguish these possibilities, we isolated subclones from cells with silenced PTRE-HPRT that spontaneously reactivated expression and used selection for HPRT to maintain the reactivated state for at least one month (∼50 cell divisions).

Plosone

Since this taxes working memory and working memory is limited in capacity, the eye movements compete for attention with the reactivated memory [ 17].

BMC Psychiatry

Participants' responses were influenced by the size of the inducers for the perceptual and the reactivated size of the inducers.

Acta Psychologica

The reactivated mTORC1 is important for lysosomal reformation (Yu et al., 2010).

Protein & Cell

Expert writing Tips

Best practice

When using "for the reactivated", ensure the context clearly indicates what is being reactivated. This helps avoid ambiguity and ensures the sentence's meaning is easily understood.

Common error

Avoid using "for the reactivated" in situations where a more specific term would be more appropriate. For example, instead of saying "This update is for the reactivated users", specify which users have been reactivated (e.g., "This update is for users who reactivated their accounts after July 1st").

Linguistic Context

The phrase "for the reactivated" functions primarily as a prepositional phrase, often serving as an adjective modifying a noun by specifying the target group or item. As Ludwig AI explains, the phrase is grammatically correct and usable in written English.

Expression frequency: Common

Frequent in

Science

50%

News & Media

37%

Wiki

13%

Less common in

Formal & Business

0%

Academia

0%

Encyclopedias

0%

Ludwig's WRAP-UP

In summary, the phrase "for the reactivated" is a grammatically correct prepositional phrase used to specify a target group or item that has been reactivated. Ludwig AI confirms its usability in written English. While its usage spans across science, news, and general contexts, it's crucial to ensure the context clearly defines what is being reactivated to avoid ambiguity. Consider alternatives like "for the restored" or "for the renewed" to add nuance. Avoiding overgeneralization and specifying which entities are reactivated will enhance clarity in your writing.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

for the restored

Focuses on the idea of something being brought back to a previous state.

for the renewed

Emphasizes the concept of something being made new or refreshed.

regarding the restarted

Emphasizes the action of starting again, with a slightly more formal tone.

concerning the re-enabled

Highlights the act of enabling something that was previously disabled.

pertaining to the revived

Implies something brought back to life or vigor.

with respect to the regenerated

Focuses on the process of renewal and regrowth.

in relation to the awakened

Suggests something that was dormant and is now active.

considering the re-established

Emphasizes the act of setting something up again.

in connection with the resurrected

Implies something brought back from a state of near-death or inactivity.

about the re-instated

Highlights the act of restoring someone or something to a previous position.

FAQs

How can I use "for the reactivated" in a sentence?

Use "for the reactivated" to specify the intended recipient or target of an action or feature, particularly when something has been restored or re-enabled. For example, "The promotional discount is "available to" the reactivated accounts."

What's a good alternative to "for the reactivated"?

Alternatives include phrases like "for the restored", "for the renewed", or "regarding the restarted", depending on the specific nuance you want to convey.

When is it appropriate to use "for the reactivated"?

It is most appropriate when referring to accounts, systems, services, or processes that have been brought back into active use after a period of inactivity or suspension.

Is "for the reactivated" grammatically correct?

Yes, "for the reactivated" is grammatically sound and functions as a prepositional phrase. However, ensure that the context clearly defines what has been reactivated to avoid ambiguity.