Sentence examples for for rat from inspiring English sources

There is no representative annotation for rat lncRNAs.

Carlson, M. Org.Rn.eg.db: Genome Wide Annotation for Rat.

(A) One-week GL protocol for rat model (Experiment 1).

Comparable data for rat and rabbit are also discussed.

Some use sledgehammers to knock holes through house walls for rat runs to avoid snipers.

Table 4 Sequences of the primers used (5′ to 3′) for rat.

The target sequences for rat NOX1 and NOX2 were GCAACTGTTCATACTCTTTCC and GGTCTTACTTTGAAGTGTTCT, respectively.

Savastano, L. E. et al. A standardized surgical technique for rat superior cervical ganglionectomy.

These proteins create "cues" for rat muscle cells deposited on the plastic, guiding their alignment.

Therefore, we merged two most highly used annotations for rat genes.

Though measures like money-for-rat-tail were taken even then, the situation had gone out of control.