Sentence examples for for producing forward from inspiring English sources

Exact(1)

This study shows that a new GPU-based Monte Carlo simulation algorithm for producing forward projections in the SPECT reconstruction can generate high-quality clinical images within 3 min, with a clearly improved recovery compared with attenuated corrected OSEM reconstruction and with similar recovery as the clinically used state-of-the-art reconstruction with resolution recovery corrections.

Similar(59)

While this can lead to controversial or insensitive content, it also provide a grounds for experimentation that produces forward-thinking art.

Sure enough, this year's bestsellers have provided plenty of reason for gloom about our ability to produce forward-looking music.

Each month, data firm Markit produces forward-looking surveys for activity in the three main sectors of the economy: services, manufacturing and construction.

An optical arrangement for producing DFWM in the forward geometry is described that results in reliable signal generation with excellent signal-to-noise ratio from the skip-fired engine.

Because of its mutation-inducing property, EMS is also very useful for producing leaky alleles in forward genetics.

These sequences are decoded to assign the resource for producing packed products according to forward assignment strategy and resource selection rules.

The primers for B4GALNT3 (NM_173593; Forward: TGTTGAGATGGCACTGAAGAG; Reverse: TGGAGGTCACAGAGGAAGATG), an enzyme responsible for producing GalNAcβ4GlcNAc (LacdiNAc) termini [ 34], were designed using AlleleID software.

It appears that the method for producing STAP stem cells is not as simple and straight forward as has been reported.

In order to move forward, we need to embrace technology both as a means of production and a method for producing new roles.

The National Milk Producers Federation has come forward with a program to try to bolster prices through buying and slaughtering dairy cattle and paying farmers for producing less milk.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: