Sentence examples for for one base from inspiring English sources

Suggestions(1)

Exact(11)

After multiplexed sequencing of the 16S PCR products, sequences were assigned to samples on the basis of their MID tag, allowing for one base error.

In an attempt to modify the relevant Fickian release profiles by varying the area exposed to the medium, matrix systems coated with an impermeable film except for one base (CMs) or for the inner surface of a central drilled hole (PCMs) were investigated.

The other base pairs, except for one base pair at each end, retain normal Watson Crick hydrogen bonding, as supported by NOEs between imino and amino protons.

The parSc site was identified using the 16-bp consensus sequence (5′-TGTTNCACGTGAAACA-3′) allowing for one base pair mismatching and only one site was found [ 24].

The Alcoy and Lens strain repeats are almost identical, except for one base (adenine in the Alcoy strain and cytosine in the Lens, GTT(A/C ACTGCCGCACAGGCAGCTTAGAA).

We found that the sRNAs that were not mapped to the genome, mapped perfectly with the genome sequences except for one base mismatches (OMM).

Show more...

Similar(48)

For a film centered on the madness arising from reason, it's singularly devoid of irony; for one built on absurd contrasts, it's humorless; for one based on rapid calculations based on changing circumstances, it's ludicrously impractical.

For a given alloy composition, the decomposition mechanism is strongly temperature dependent, which would be expected for homogeneous precipitation via the compositional fluctuation-mediated mechanism but not necessarily for one based on classical nucleation theory.

(Not to knock American Idiot, a raw, visceral theater experience. I'd trade every show running for one based on a Green Day album. Dookie: The Musical? We can dream...) Perusing the listings in the back of my Playbill, I realized that The Book of Mormon is currently the only first-run, non-adaptation, non-review musical on Broadway.

On the Republican side, primary voters appear to believe otherwise, opting in large numbers for Trump, the bombastic frontrunner who has eschewed a conventional, policy-based campaign for one based around emotions and public confrontations, such as his encounter this week with Pope Francis.

John Wakeham, for one, based his certainty not on private or published opinion polls but on the feedback from trusted party officials on the ground.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: