Sentence examples for for minor problems from inspiring English sources

They had been prescribed the drugs by local practitioners for minor problems.

Normally there are five levels of care — Level 1 is for minor problems like an earache.

Building records show the elevators failed all but one of their last 18 inspections since 2004, though most have been for minor problems.

Many of the detainees in the New Jersey jails were originally stopped for minor problems, like traffic violations, or because neighbors viewed them as suspicious.

On routine inspections, about 20percentt of the Housing Authority's elevators receive satisfactory ratings and the rest receive unsatisfactory findings, though agency officials said most of the unsatisfactory marks were for minor problems.

Authority officials said the 17 unsatisfactory ratings the elevators received in the last 21 inspections were mostly for minor problems like broken light bulbs, but officials have failed to provide detailed inspection records to reporters.

Repairing these types of minor problems is costly for the contractor.

While there are ways to expedite critical security fixes, for more minor problems, like crashes that only affect a subset of users, user interface glitches, or other changes a developer wants to make – like adding a new event to track via an analytics provider, for example – developers are still stick waiting out the app submission and approval cycle.

Using short stay unplanned admissions as a proxy indicator for identifying minor problems assumes that the admission was inappropriate.

This is probably because megablast reports non-overlapping matches, which is a matter of choice – note that the above sequence is a repeat of the 5-letter word GTGTT the query TGAATTCGGTCTTGCCTTGAACACA found a spurious perfect match on the genomic sequence NGAATTCGGTCTTGCCTTGAACACA. Except for these minor problems, all three tools reported the same hits.

A minimum length of stay of 48 hours was used to exclude short admissions for more minor problems, e.g. transient respiratory problems associated with CS, and those where a lower threshold of admission might apply due to onsite availability of neonatal care.