Our present work provided an efficient approach for the preparation of the recombinant INSL6 peptide and its analogues for further studies of this important peptide.
However, given that such a clear picture of QoL is produced with the EORTC QLQ-C30 we would recommend its use for further studies of interferon treatment.
Although this model depicted and uncovered the conservation between zebrafish and human liver tumorigenesis, the low tumor incidence and early mortality limit its use for further studies of tumor progression and inhibition.
Based on these results, the 12.5 mg/mL CFI formulation containing 0.4% polysorbate 20 added under hypotonic conditions was selected for further studies for its potential as an inhaled product.
Although the Diagnostic and Statistical Manual of Mental Disorders (DSM), Fourth Edition, acknowledges the existence of dissociative trance and possession disorders, simply named dissociative trance disorder (DTD), it asks for further studies to assess its clinical utility in the DSM-5.
One of the clones with sequence GAGAGGCACUACUUUCGAAUU in the loop was selected for its better performance and used for further studies.
We showed that pro-apoptotic BCL2-interacting killer gene (BIK/NBK) overexpressed in nearly all samples (14/15), which makes it a possible candidate for further studies on its role in breast cancer.
ACS was selected for further studies and its potential as a mediator for the decolorization of IC was evaluated.
Thus, it represents a strong candidate for further studies to improve its activity on pathogenic trypanosomatids.
Although the difference in transcript ratio between BPH and PCa was significant for all four biomarkers, claudin-4 was selected for further studies because of its high differential level of expression overall.
