Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
Data collected were: patient's demographics, grade of operator, approach used, number of attempts, indication for insertion, use of ultrasound probe, type of catheter and complications.
Similar(59)
Space available for penetrometer optics was constrained by a several practical design requirements: (a) ability to collect in situ soil VisNIR reflectance and insertion force simultaneously; (b) thick probe walls strong enough for insertion into dry soil with high clay content; and (c) a narrow enough cross-sectional diameter for insertion using a standard soil coring hydraulic push system.
The flanking sequences were then blasted against LA 1589 sequences for deletion or Heinz 1706 sequences for insertion using local BLASTall with an E-value of e−20 to remove hits with low similarity.
Evidence-based interventions effective in combating CLA-BSIs include: using chlorhexidine skin preparation and maximal sterile barriers (MSB) during insertion of central venous catheters (CVC), use of checklists for insertion, using the subclavian or internal jugular vein instead of the femoral vein, and daily review of line necessity [ 5- 13].
To optimize prevention, it is now accepted that the "bundle" concept should be implemented, including five simple interventions supported by strong scientific evidence for effectiveness: optimal hand hygiene, chlorhexidine skin antisepsis, maximal barrier precautions for CVC insertion, use of optimal insertion sites, and prompt catheter removal [ 17].
Briefly, baseline infection control interventions included daily environmental cleaning, cleaning of equipment between patients and use of 'aseptic non-touch technique' for all line insertion, use and care.
In this paper, we propose a policy for data insertion using a statistical approach and we design a set of experiments based on California wildfire where Santa Ana winds generate the ideal conditions for sudden changes in fire behavior.
The number of attempts required for LMA insertion using either technique was also comparable statistically.
Genitors were polymerase chain reaction (PCR) genotyped for GFP insertion using the primers (from 5′ to 3′): ATGGTGAGCAAGGGCGAGGAGCT and GCCGAGAGTGATCCCGGCGGCGGT.
Between 1 February 2003 and 1 August 2003 we prospectively collected data regarding the use of US for CVC insertion using the Sonosite180PLUS ultrasound machine at a 14-bed general intensive care unit.
The resulting colonies were screened for the proper insertion using PCR with primers C1 and BA1818.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com