Your English writing platform
Discover LudwigSuggestions(3)
Exact(1)
Luciferase counts were corrected for input using Renilla counts.
Similar(59)
Table 1 also displays summary statistics for inputs used in our human capital composite.
Most Web sites with fields for input use CGI, and a great deal of the dynamic content on the Web is done using CGI.
The first row shows a process which produces a commodity for input use (the first commodity).
The first of the normal production processes is one which produces a commodity only for input use (the first commodity), inputting itself and labor.
The first and second rows show a process which produces a commodity for input use by means of a brand-new material, and one which produces a commodity for consumption use, respectively.
Each reaction was normalized for DNA input using ALU-C4 as a reference.
We corrected the Ct values of each sample by the Ct value obtained for the corresponding input using the same primers or using unrelated primers.
Expression values were normalized for differences in cDNA input using parallel reactions employing primers designed against a reference gene HbUBC2B (HbUBC2B7).
When combined with the equal output and input price assumptions, this implies that the cost shares are the same for each input used in the two industries.
A region of β-actin, devoid of any CpG dinucleotide was used to normalize for input DNA using the following primer pairs: ACTB-forward 5' TGGTGATGGAGGAGGTTTAGTAAGT and ACTB-reverse, 5' AACCAATAAAACCT ACTCCTCCCTTAA.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com