Sentence examples for for amplifying from inspiring English sources

Primers used for amplifying Vap33-1 specifragmentsents were: CCGGCCGTCAAACAGGTG and TGCCCAGCAGGAGGCTAACG. Primers used for amplifying E74 specific fragments were: GGAGCGAATGGACAAGCTCA and GCTGTTGCAGGTGGTGCT.

Consider how hospitals discovered a process for amplifying and exploring potential threats to patients.

The primers used for amplifying each gene were listed in Table S18.

Primers used for amplifying specific genes are shown in Table 1.

A patch-clamp amplifier (Dagan, Minneapolis, MN) was used for amplifying currents.

It is especially suitable for amplifying RNA.

Psychologists have long studied methods for amplifying this contrast.

Transistor, semiconductor device for amplifying, controlling, and generating electrical signals.

Wheel and axle, basic machine component for amplifying force.

William Styron, in his 1990 memoir, "Darkness Visible," blamed Halcion for amplifying his suicidal thoughts.

The Internet's facility for amplifying rumors has also played a role.