Sentence examples for for a standard reference from inspiring English sources

where the element symbols represent concentrations in the concretion normalised to values for a standard reference sample.

Concentrations for a standard reference curve were included on each plate per manufacturer's instructions.

Samples were dissolved in HPLC-grade methanol (Sigma-Aldrich, Germany) and two-fold serially diluted to concentration ranges of 1000 to 7.81 μg/ml for extracts and fractions, and 40 to 0.31 μg/ml for a standard reference L-ascorbic acid (Sigma, Germany).

It is expressed as percentage of children under-five, by district, whose height-for-age falls below minus 3 standard deviations from the median height-for-age of a standard reference population used in the Multiple Indicator Cluster Survey 2006.

His first book, The Production and Measurement of High Vacuum (1922), was for many years a standard reference.

Serum was analyzed for creatinine against a standard reference range of 66 106 μmol/L.

For quality control, a standard reference material (SRM1643d water; National Institute of Standards and Technology, Gaithersburg, MD, USA) was periodically analyzed.

The obtained closed form analytical expressions for stress can be a standard reference tool in this important area of stress-modulated soft tissue growth.

The reporter synthesis rate calculated for a culture containing an uncharacterized promoter can be compared to the synthesis rate calculated for a culture containing a standard reference promoter grown in parallel.

Universal Product Code numbers for 39,408 dairy product purchases were linked to a standard reference for food composition to estimate the nutrient content of foods purchased over time.

β-actin (Forward5'ATCATGTTTGAGACCTTCAA3', Reverse 5 CATCTCTTGCTCGAAGTCCA3') was chosen as a standard reference gene for the assay for normalization.