Sentence examples for footprints used from inspiring English sources

Suggestions(1)

Exact(3)

PCR analysis of ET500 excision sites (footprints) used 36 cycles of 30s 96°C 30ss (63°C 90s (72°C) (Primers were: 318E, 5'CAAGGTTGGATTCandGGAATCCTATTGTTCTTGAG3'; T6158237E-2CTTACGTACATGGTCGATAAGAAAAGGCAATTTGTAGATG3'; and 58237E-2, 5'TAACAAGAATGAGATATAAAGTATCACCTTCTCATCATGAG3').

To ensure that footprints correspond to elongating and not initiating ribosomes, the only footprints used were those that align downstream of the first 30 nt, but upstream of the last 75 nt of coding ORFs.

For T-box-containing loci of differential footprints used in Fig.  2b average DNaseI cleavage profiles are shown before (a, c) and after (b, d) correcting for the sequence specificity of DNaseI cleavage using a 6-mer model (He et al., 2013).

Similar(57)

The widespread use of carbon footprints using existing knowledge needs to be encouraged and even regulated.

Visualization of carbon footprints using methods such as carbon footprint labeling helps communicate to consumers how reductions in household consumption can be effective for reducing GHG emissions.

This paper also undertakes a regional analysis of carbon footprints using the constructed MRIO table; the results are shown to have important implications for climate policy.

Femoral tunnel placement was determined at an equidistant point between the anteromedial and posterolateral femoral footprints using the BullsEye femoral guide (ConMed Linvatec, Largo, FL, USA).

In other words, we preserve the number of individual footprints for each customer and the number of collective footprints, while we destroy the assignment returned by the clustering, and we label each individual footprints using a randomly selected collective footprints instead of using the one of the cluster where it should belong to.

When only textual descriptions of refugial locations were available, we converted descriptions into polygon footprints using techniques similar to those for georeferencing occurrence localities [60].

Footprint coverage estimated the percentage of each feature covered by ribosome footprints using the BEDTools coverageBed command.

We designed the high-throughput footprint detection method to enrich for footprints using primers specific to the two consensus footprint sequences [5'-TACAGTA-3' and 5'-TAdditional (Additional file 1: Figure S1).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: