The primers used were as follows: forward, 5′-CGCGGATCCACCATGGGGGGCACCC-3′; reverse, 5′-TCCGCTCGAGCGTCAGTGCCCGGGGATCACGTAC-3′.
The α-tubulin primers were as follows: forward 5'-GTACATGTTGGTCAAGCTGGTGT-3' and reverse 5'-AGTTCGCACTTCATCCACTACAGT-3'.
The sequence of the Runx1 primer set is as follows: Forward, GCAGGCAACGATGAAAACTACT; Reverse, GCAACTTGTGGCGGATTTGTA.
The sequence of the TLX1 primer set (659 777) is as follows: Forward, TCCACCGCCAGAAGTACC; Reverse CTGCCGTCTCCACTTTGTC.
The sequence of the Ccr7 primer set is as follows: Forward, GAGGGCTAGCTGGAGAGAGA; Reverse, GCAGAAGCACACCTGGAAA.
The sequence of the Aldha1 primer set is as follows: Forward, CCGACTTGGACATTGCTGT; Reverse, AGCTCGCTCAACACTCCTTT.
The primers used were as follows: forward (F): 5'-ATGGAGACTCCAGGTCAGAAAC-3', reverse (R): 5'-AAGCACAGATGGTCAGGGTTTG-3'.
The primers for the PCR were as follows: forward, 5'-CGCGGATCCTGCAGCTCGAG-3'; reverse, 5'- TGCTCTAGAAGCTTGTCGAC-3.
Primers used for eNOS were as follows: forward, CAACGCTACCACGAGGACA; reverse: CTCCTGCAAAGAAAAGCTCTG from Sigma Genosys.
The primer sequences were as follows: forward: 5'-TCGCTCTCTCTCTCCTTCTCACAC-3' and reverse: 5'-ACCCTCTTCCTCGGACCTTACATC-3'.
Sequences are as follows: forward primer TCATCTTCAGCCACGCTGT, reverse primer CACGGTGCTGGAACATCTC.
