Your English writing platform
Discover LudwigExact(2)
Ad/Cre-GFP was purchased from Vector Biolabs (catalog no. 1700) while Ad/EGFP was generated as follows: coding sequence of EGFP was cloned into NotI and HindIII sites of pShuttle-CMV expression vector (Quantum Biotechnologies, Quebec, Canada).
The sequences were as follows: coding sequence (CDS; Dharmacon) GCAUCGAACCAUUAGCAGAUU, untranslated region a (UTRa) (Dharmacon) CGAAGGAAGUAUCGAAUUU, and UTRb (Qiagen) CCCGCCGAAUUCAUUAAAUUA.
Similar(55)
Following coding the authors compared notes and held extensive discussions about the themes identified.
The PBI scale is as follows: Code 0: no bleeding.
Codes of the TDI were as follows: code 0=no TDI, code 1=treated TDI, code 2=enamel fracture only, code 3=enamel/dentine fracture, code 4=pulp injury, code 5=tooth missing due to trauma.
BEWE case definitions are as follows: Code 0: no erosion: Code 1: initial loss of surface structures (e. g. shine, perikymata).
Following coding procedures of the original English protocol, narratives were transcribed and scored according to 27 features within five categories: sentence structure, phrase structure, modifiers, nouns, and verbs.
Following coding of all interviews content codes were collated into key themes.
Following coding, data were summarised into initial themes which identified associations and subsequent development of explanatory accounts.
Following coding, a full list of themes was available for categorization within a hierarchical framework of main and sub-themes.
Following coding, codes related to the analytic focus on 'attitudinal characteristics' were extracted from the dataset and shared with all authors in preparation for thematic analysis.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com