Your English writing platform
Discover LudwigExact(32)
Mechanical specifications are the following: probe handle of 20 cm, aperture detector of maximum 10 mm, outside diameter of maximum 30 mm and weight of 500 g.
UC Davis chancellor resigns following probe into ethical violations.
The log2 transformed data for the following probe sets have been evaluated: RANK, RANKL, OPG.
3. Probe tests: After the tool-use training, the following probe tests were administered to examine the degus' functional understanding of the tool (Fig 4, Table 1).
Although fold-changes were lower than our cutoff, all probes in the following probe sets showed increased expression in the spleen: interleukin-17A/F-like (146326) and its precursors (e.g., 144803), MHC complex proteins (e.g., 443195), myd88 (a key molecule in relaying the signal from toll-like receptors, 294414), and complement (e.g., 296194, 194000).
All mice were imaged at 1, 3 and 6 h following probe injection.
Similar(28)
Mining firms have exhausted their final avenue of appeal against New South Wales laws that cancelled coal licences following probes into figures including the former Labor powerbroker Eddie Obeid.
The following probes have been used with this mounting device: Needle-based intracranial pressure probes, 1.3 mm diameter: these are introduced as shown in Figure 2.
The following probes were used for WMISH: Sox9 [16]; 3β-HSD (IMAGESTST clone 580043); Oct4 [17].
The following probes were used: wild-type κB probe (AGTTGAGGGGACTTTCCCAGGC), mutant κB probe (AGTTGAGGCGACTTTCCCAGGC), and Sp1 probe (-ATTCGATCGGGGCGGGGCGAGC).
Membranes were stripped following probing with the labeled E7 DNA mixture and reprobed with beta actin as a loading control.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com