following considerable use

USAGE SUMMARY

The phrase "following considerable use" is correct and usable in written English.
It can be used to indicate that something has occurred after a significant amount of usage or application of a particular item or concept. Example: "Following considerable use, the software began to show signs of wear and required an update."

✓ Grammatically correct

Human-verified similar examples from authoritative sources

Similar Expressions

59 human-written examples

Previous studies support our findings that SREs following metastatic bone disease are associated with considerable use of resources, particularly in relation to inpatient hospitalizations.

Clinical Epidemiology

Both are likely to make considerable use of their assistants.

The Guardian - Sport

While there appear to be considerable improvements in pain and other measures following treatment using such devices, this trial suggests that the effect is not specifically due to laser at the low dosage commonly used in clinical practice.

Acupuncture in Medicine

There was considerable support among respondents for a clinical trial evaluating outcomes following both the use of different irrigating solutions as well as irrigating pressures [803 (84.8%) and 730 (77.6%) respectively] (Tables 7 and 8).

BMC Musculoskeletal Disorders

The data for overall tumours are lower, though still considerable (up to 2-3 times normal incidence) and s.s., while the risk of contralateral tumours is not s.s., except for astrocytoma following use of cellular phones.

Environmental Health: A Global Access Science Source

The cumulative freedom from VT following procedures using 3D-electroanatomical mapping and/or epicardial approach was significantly greater than conventional ablation, although the recurrence rates remain considerable.

Circulation

The following sequences were used.

Plosone

The following siRNAs were used for transfection.

Plosone

The following sequences were used: hE72+20+39 5'UGAGUAUCAUCGUGUGAAAG3'; hE72+20+395 5'UCCUUUCAUCUCUGGGCUC3'; hE72+20+395'AACUUCCUCUUUAACAGAAAAGCAUAC3'; mE23+2-18 5'GGCCAAACCUCGGCUUACCU3'.

Plosone

The following measurements were used (Figure 5).

Plosone

Radio stations like AmmanNet and television stations like LinkTV and even Al-Jazeera and Al-Arabiya are ample examples of these offerings which have a considerable following brought in through their extensive use of multi-facetted media and interactivity.

Huffington Post

Expert writing Tips

Best practice

When using "following considerable use", ensure the context clearly defines what was being used and what the consequences were. This enhances clarity and avoids ambiguity.

Common error

Avoid using "following considerable use" when the actual usage was minimal or insignificant. Reserve it for scenarios where the use was genuinely substantial and had a noticeable impact.

Linguistic Context

The phrase "following considerable use" functions as a prepositional phrase that introduces a clause indicating a consequence or result. It specifies that the mentioned effect or outcome occurred after a significant amount of something was used. Ludwig AI confirms its correctness.

Expression frequency: Missing

Frequent in

Science

0%

News & Media

0%

Formal & Business

0%

Less common in

Science

0%

News & Media

0%

Formal & Business

0%

Ludwig's WRAP-UP

In summary, the phrase "following considerable use" is grammatically correct, as confirmed by Ludwig AI, and serves to establish a clear temporal and causal link between extensive utilization and subsequent outcomes. Due to the absence of examples in the search data, its frequency is categorized as missing. While adaptable across various contexts, its formal tone renders it particularly apt for technical, scientific, or professional settings. The phrase's effectiveness hinges on clearly specifying the utilized entity and its resulting consequences. While alternatives like "after substantial usage" or "subsequent to significant application" exist, "following considerable use" precisely conveys the intended meaning.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

after substantial usage

Replaces "considerable" with "substantial", emphasizing the amount of use.

after extensive utilization

Substitutes "considerable use" with "extensive utilization", highlighting a more formal tone.

subsequent to significant application

Replaces "following" with "subsequent to" and "considerable use" with "significant application", creating a more formal and emphatic expression.

after prolonged employment

Emphasizes the duration of use, replacing "considerable use" with "prolonged employment".

once heavily applied

Focuses on the intensity of the application, using "heavily applied" instead of "considerable use".

after significant exposure

Highlights the exposure aspect of use, replacing "considerable use" with "significant exposure".

in the wake of substantial use

Uses "in the wake of" to indicate sequence and "substantial use" to highlight the extent.

after appreciable use

Replaces "considerable" with "appreciable", indicating a noticeable amount of use.

following a long period of use

Specifies the duration of use, emphasizing the length of time.

after much implementation

Focuses on the implementation aspect of use, using "much implementation" instead of "considerable use".

FAQs

How can I rephrase "following considerable use"?

Alternatives include "after substantial usage", "subsequent to significant application", or "after extensive utilization" depending on the context and desired formality.

Is "following considerable use" grammatically correct?

Yes, "following considerable use" is grammatically correct. It functions as a prepositional phrase indicating a sequence of events that occur after a significant amount of something being used. Ludwig AI confirms its correctness.

In what contexts is "following considerable use" most appropriate?

While the phrase can be used in various contexts, it's best suited for situations where you want to emphasize that a noticeable change or effect occurred only after a significant amount of something was utilized. Examples would be in scientific reports, technical manuals, or business analyses.

What's the difference between "after considerable use" and "following considerable use"?

"After considerable use" and "following considerable use" are largely interchangeable. However, "following" might suggest a more direct causal relationship or a closer temporal sequence than "after".