Sentence examples for followed forward from inspiring English sources

The study design was a retrospective, cohort study of adults from Ontario, Canada using administrative databases: individuals were assigned a predicted illness burden score using a case-mix adjustment system from diagnoses and health utilization data in 2008, and then followed forward to assess the actual health care utilization and costs in the following year (2009).

To develop the dashboard generally, individuals were assigned a predicted illness burden score using a case-mix adjustment system from diagnoses and health utilization data occurring in fiscal year 2007 08, and then followed forward to assess the actual health care utilization and costs in the following year (fiscal year 2008 09).

Equity derivatives followed: forward contracts on VOC shares were being traded by 1607.

Suárez Navarro earned her only two break points of the match in the 11th game, but Williams saved both with strong serves out wide to Suárez Navarro's backhand that she followed forward to the net.

Among women denied abortion, 220 children were then followed forward in time.

IHD cases comprising medical management alone, PCI or CABG cases were followed forward from the date of their procedure until March 31, 2006 (or death or loss to follow-up) to determine rates of onset of dementia or depression.

The path to athletic beauty is the one we will follow forward to the more than human.

Bullman had no idea, when he chose families to follow forward, what he would discover about their descendants.

The primers used were as follows: forward, 5′-CGCGGATCCACCATGGGGGGCACCC-3′; reverse, 5′-TCCGCTCGAGCGTCAGTGCCCGGGGATCACGTAC-3′.

Primer sequences were as follows: forward, GCACGATCAGTTCAAGGCAAC; reverse, GCTGAGGGTGATGTAGGGATTG. Probe sequences were for C1747T: forward, VIC-CGAGGCTGACCGAGAG; reverse, FAM-CCGAGGCTGACTGAGAG.

Primers for FOXO3a were as follows: forward primer 5'- TGCTAAGCAGGCCTCATCTC, reverse primer 5'-GCTCCCTGGACACCCATTCC. Primers for 18S rRNA are as follows: forward primer 5'- GGACACGGACAGGATTGACA, reverse primer 5'- ACCCACGGAATCGAGAAAGA.