Sentence examples for followed codes from inspiring English sources

Like Busch Stadium, it followed codes, but the law said it had too many fixtures for women (120, compared with 103 for men).

Large buildings such as hotels, hospitals, factories, museums and office blocks are particularly vulnerable and managers of such buildings are required to follow codes of practice.

On Quora, you can follow questions, and on GitHub, you can follow code.

Following coding procedures of the original English protocol, narratives were transcribed and scored according to 27 features within five categories: sentence structure, phrase structure, modifiers, nouns, and verbs.

The PBI scale is as follows: Code 0: no bleeding.

Following coding of all interviews content codes were collated into key themes.

However, HP1 homologs do not always follow code (Cryderman et al., 2005; Li et al., 2002).

Following coding the authors compared notes and held extensive discussions about the themes identified.

Following coding, data were summarised into initial themes which identified associations and subsequent development of explanatory accounts.

The sequences were as follows: coding sequence (CDS; Dharmacon) GCAUCGAACCAUUAGCAGAUU, untranslated region a (UTRa) (Dharmacon) CGAAGGAAGUAUCGAAUUU, and UTRb (Qiagen) CCCGCCGAAUUCAUUAAAUUA.

Following coding, a full list of themes was available for categorization within a hierarchical framework of main and sub-themes.