Sentence examples for followed assembly from inspiring English sources

But the vote, which followed Assembly approval of the bill in June, put the Board of Education, once again, out of business.

Mr. Silver told reporters on Wednesday that he had followed Assembly protocol and forwarded the e-mail messages to the chairman of the committee for examination.

Following assembly by the JGI's in-house "pga.lucy" assembler, the unique sequence data is evenly split between assembled contigs (52.6% of sequence) and singletons (47.4% of sequence) (Table 2).

Following assembly, BarcodeCruncher analyzed both the best (lowest e-value) single read and assembled contig for each barcode and targeted gene to determine which had the highest overall quality.

Following assembly of over 75 million Illumina reads (101 nt long) 16,683 contigs were obtained from which 4078 coding sequences were extracted.

Following assembly, the antibody genes were amplified by 35 cycles of PCR (same as above) using the assembly reactions as templates.

Following assembly, 350 uL of DEPC-RSB200 buffer was used in the initial immunoprecipation (IP) steps via primary bead fractions Protein G Plus/Protein A Agarose suspension with PBS (Oncogene) pre-blocked with 25 µg of whole HeLa cell extracts.

Following assembly of nascent TMR-labeled CENP-A-SNAP in early G1, cells were collected in thymidine at the end of G1, fixed and counter stained for CENP-C (gift from W. Earnshaw) and DAPI.

Following assembly with both PCA and LCR, target product was then selected for through PCR amplification using the forward and reverse primers (5'−>3') TCCCGCTCCGTCTCCACCTCCGC | ACAGGAAGGCAATGCTGCTCTGGA (IGF2R) [25] and CGCCTCCCTTCCCCCTCCCC | ACTTGGGGTTGCTCCGTGCC (BRAF).

Following assembly, 42,062 consensus sequences were detected.

Following assembly and editing, the genomes underwent automated gene annotation.