Sentence examples for follow underlined from inspiring English sources

Exact(2)

A) The presentation of the data in Figure 5 is very hard to follow: "Underlined values indicate that the amino acid in question (Thr in this case) is already present in a certain background, and the effect is calculated as its reintroduction after removal (reversion of wt PTE-t45A to wt PTE)." So some effects are measured in one direction and some in the other, I think.

A) The presentation of the data in Figure 5 is very hard to follow: "Underlined values indicate that the amino acid in question (Thr in this case) is already present in a certain background, and the effect is calculated as its reintroduction after removal (reversion of wtPTE-t45A to wtPTE)." So some effects are measured in one direction and some in the other, I think.

Similar(58)

A technico-economic approach will follow, underlining their main incentives and drawbacks within the framework of future environmental constraints.

The sequences of the forward strands were as follows (underlined letters denote phosphorothioate-bonded bases; mutated bases are printed in bold and italics).

should be underlined.

Zeta potential measurements were performed on a Nano-ZS Zetasizer ZEN3600 (Malvern Instruments Ltd., U.K .. Oligonucleotide sequences are listed as follows (mismatch underlined).

In what follows, we underline the advantages of using this demographic to identify public service motivation among public sector workers, while in the conclusions, we elaborate on some of its limitations.

The reverse primer contains the XhoI restriction site (underlined) followed by 15 base pairs that correspond to the coding region of the PAD2 gene.

5. Number of total insertion/deletion and microsatellite polymorphisms observed within F. keratoplasticum (underlined), followed by the number of alleles observed at each, i.e. locus 5437 contains 2 such polymorphisms, one of which has 11 alleles.

DNA templates encoding truncated TNFα constructs were prepared by PCR using a forward primer that contained a T7 promoter (bold) and a Kozak consensus sequence (underlined) followed by a region complementary to the 5′-end of TNFα (5′- GCCTAATACGACTCACTATAGG GAGACCATGAGCACTGAAAGCATGATCCGG-3′).

Then we can define a total order in Λ f as follows: for (underline {i}_{1}), (underline {i}_{2} in Lambda _{f}), we define (underline {i}_{1} geq underline {i}_{2}) if (sum underline {i}_{1} geq sum underline {i}_{2}).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: