Sentence examples for follow forward from inspiring English sources

The path to athletic beauty is the one we will follow forward to the more than human.

Bullman had no idea, when he chose families to follow forward, what he would discover about their descendants.

The primer sequences for hR amplification are as follow: forward primer: 5′-TCAGGTACCATGGCCATGAAAGCTCTCTGTCTCCTC-3′; reverse primer: 5′-TCGGAATTCTCAGGGCTGCACACGACAGC-3′.

The sequences of the VDR primers were as follow: Forward 5'-TCA CTG ATG GAT CTG ATG GC-3' and reverse 5'-CTG AAT CTG ACG AAG TCG GA-3'.

Equity derivatives followed: forward contracts on VOC shares were being traded by 1607.

The primers used in this experiment for Oxtr were as follows: forward (5′-TTCTTCGTGCAGATGTGGAG-3′) and reverse (5′-CCTTCAGGTACCGAGCAGAG-3′).

The miR-223 quantitative primers were as follows: forward primer 5′-ACACTCCAGCTGGGACCCCATAAACTGTTT-3′; and reverse primer: 5′-TGGTGTCGTGGAGTCG-3′.

The primers used were as follows: forward, 5′-CGCGGATCCACCATGGGGGGCACCC-3′; reverse, 5′-TCCGCTCGAGCGTCAGTGCCCGGGGATCACGTAC-3′.

Primer sequences were as follows: forward, GCACGATCAGTTCAAGGCAAC; reverse, GCTGAGGGTGATGTAGGGATTG. Probe sequences were for C1747T: forward, VIC-CGAGGCTGACCGAGAG; reverse, FAM-CCGAGGCTGACTGAGAG.

Among women denied abortion, 220 children were then followed forward in time.

Primers for FOXO3a were as follows: forward primer 5'- TGCTAAGCAGGCCTCATCTC, reverse primer 5'-GCTCCCTGGACACCCATTCC. Primers for 18S rRNA are as follows: forward primer 5'- GGACACGGACAGGATTGACA, reverse primer 5'- ACCCACGGAATCGAGAAAGA.