Sentence examples similar to fold repetitive from inspiring English sources

We analyzed the possibility of using the 35-fold repetitive B1 gene via high-resolution melting (HRM) curve analysis.

In this study, we used a conserved sequence in the 200- to 300-fold repetitive 529 bp gene of Toxoplasma gondii to design primers for LAMP test.

Consider RTB as an example to show the four three-fold repetitive (FTR) motifs in detail.

Using WHAT IF [35], we find that the four three-fold repetitive motifs are almost buried in the interior of their structures.

In fact, for RTB, Haze detected a three-fold repetitive QXW motif in both domains and regarded them as key structural residues [19].

Are the three-fold repetitive key structural residues special for beta-trefoil proteins in PCB family or common for all proteins sharing beta-trefoil fold?

Parasite DNA was amplified with primers specific for a 35-fold repetitive sequence of the B1 gene (5'-TCTTTAAAGCGTTCGTGGTC-3' and 5'-GGAACTGCATCCGTTCATGAG-3'), which is found in all known parasite strains [15].

For specific T. gondii detection, real-time polymerase chain reaction (PCR) was performed with the use of a pair of primers 5′ TCGAAGCTGAGATGCTCAAAGTC 3′ and 5′ AATCCACGTCTGGGAAGAACTC 3′ targeting the 129-bp fragment of 35-fold repetitive B1 gene and the fluorescently labelled TaqMan probe 5′ FAM ACCGCGAGATGCACCCGCA TAMRA 3′ [ 5].

The two proteins are structurally-related and fold into repetitive protein domains termed short consensus repeats (SCRs) [14], [15].

In the second population, neurons were potentiated 1.7±0.3 fold by repetitive 2-aminoethyldiphenyl borate application (Fig. 6A, C), and camphor evoked a small increase in outward current (1.3 fold±0.07; paired Student's t-test, p<0.01; data not shown), consistent with TRPV3 activity.

X-ray structural analysis of this region in TcdA revealed that these sequences fold into repetitive solenoid-like structures that have potential as vaccine candidates.