Old tub? Cunard really flounders Top marks for public relations gaffe of the week goes to Cunard's Eric Flounders, whose job it is to whip up publicity for the launch of the Queen Mary 2. When Escape's Gemma Bowes asked to preview the ship last week, Flounders inadvertently emailed her the following message intended for one of his colleagues: 'Can you enlighten me about this woman?
But a series of miscalculations by former chairman James Robinson (including letting the company's core credit card business flounder) caused the stock to be marked down to a single-digit P/E in 1993.
Ainslie, 31, who is attempting to surpass Rodney Pattison as Britain's most successful Olympic sailor, held a 10-second lead over Croatia's Ivan Kljatovic-Gaspic athehe final mark, but floundered in the light winds on the final leg to finish 61 seconds behind Greece's Aimilios Papathanasiou at the finish.
I floundered around the "one" mark: a cockroach is a cockroach.
We applied a reduced version of the Barker mark-recapture model to estimate summer flounder mortality rates using data collected by an angler-tagging program in Virginia.
Major histocompatibility complex (MHC) class Ia, which plays an important role in the immune system, was previously sequenced from Japanese flounder (AB490772) and a microsatellite was identified in that region (Marker name: JFMHC1, Forward primer: GGCCTGGATAATGTGGACAC, Reverse primer: GAGTGTTGGGCCTTGGTG).
The 5 S rRNA gene, which is a conserved component of the large ribosomal subunit, was isolated from Japanese flounder by [ 28] (AB154836-AB154839), and a microsatellite marker was isolated from the variable non-transcribed spacer (NTS) region (Marker name: JF5SrRNA, Forward primer: TGCACCTTGAGATTGATTTTGGAACA, Reverse primer: CACCCACAATACCTCCTTTCAGTCTT).
Google and Apple sprint ahead, while bank stocks flirt with new lows and brokerages flounder in tens of billions of dollars in illiquid assets whose value remain too iffy to mark to the market.
The same polls that show her floundering in popularity and likeability also show that a crushing majority of voters give her high marks on experience.
Alana will do well – she'll probably design an actually good bath toy at some point – but, after floundering around the Week 10 mark by allowing herself to be pushed around, will then be told she still has a long way to go.
