Sentence examples for flag was incorporated from inspiring English sources

The Confederate battle flag was incorporated in to the state flag's design in 1956, a symbol of the state's opposition to racial integration, according to a report by the state Senate in 2000.

You will immediately note that the Confederate battle flag is incorporated into the state flag's design.

Following continued evaluation, parading and dipping the flags was incorporated back into the 11 00 Sunday Protestant services".

The plasmid encoding the Nde1 binding domain (NBD) of Smc3 was PCR amplified with primers ATG GATTAC AAGGATGACGACGATAAGAGACAGCAATCAGAA AAG and TTA GCGCTCCATACTTTTCTG, and a Flag tag was incorporated to the N-terminal end of the construct.

The intracellular expression levels of GAD in the engineered C. glutamicum strains were monitored by western blotting analysis using an antibody raised against the FLAG-tagged sequence that was incorporated into the cloned genes.

Perhaps as early as 1823 the Southern Cross constellation was incorporated in a flag representing Australia.

When Ireland achieved independence in 1922, green was incorporated into the national flag.

When the pattern was incorporated into Georgia's flag, the researchers wrote, the state "was in a desperate situation to preserve segregation".

As shown in Figure 1, after UV photolysis 8-azido-ATP was incorporated into recombinant SVOP-FLAG proteins.

In July 1992, IRI was incorporated.

It was incorporated in 1826.