Sentence examples for fishing solution from inspiring English sources

This is because of the large fraction of nonwoody biomass that are crops, and the domination of rice, maize, and wheat among crops.5 For the fishing solution, relatively few feedstock organisms (for example, algae) may need to be investigated.

Fish sperm are immotile in the gonads and are activated upon release into hypotonic (freshwater fishes) or hypertonic (saltwater fishes) solutions.

In general, fish were treated for three weeks in containers containing 2.5-µg/mL phenylhydrazine hydrochloride (PHZ, Sigma) fish water solution.

With fish, the solution is even simpler and more straightforward than with the other ecological crises ensnaring us.

Each well then received 100 µl of the 2% fish blood solution.

Whole-mount airways were fixed with 4% vol/vol paraformaldehyde, washed in 0.1 Triton X-100 in PBS, subjected to antigen retrieval by boiling in 10 mM citrate buffer for 40 min, and incubated in blocking buffer (3 hr; 10% FBS, 0.05% fish skin solution in PBS).

For zfper1b the primer sequences used were F: CCGTCAGTTTCGCTTTTCTC and R: ATGTGCAGGCTGTAGATCCC, while for zf β -actin the primer sequences were F: GCCTGACGGACAGGTCAT and R: ACCGCAAGATTCCATACCC. Larvae were incubated for 15 minutes in 10 mM BrdU fish water solution at different time points during a temperature or light/dark cycle and fixed in 4% PAF in PBS.

There is a growing array of technological fish-pass solutions for the movement of fish across large structures such as weirs and dams.

PSO is motivated by social behavior of birds flocking or fish schooling Solutions are represented by particles in the search space.

In zebrafish and medaka, which are model fish, mutations are introduced in spermatogonia by soaking founder fish in ENU solution [ 13, 22].

Page H2 AN OLD REMEDY RE-EMERGES When a child exhibited signs of attention deficit hyperactivity disorder, the doctor recommended an old solution: fish oil.