Sentence examples for first underlined from inspiring English sources

From a clinical view point, Juretzka et al (2004) first underlined the potential prognostic relevance of micrometastases and recommended adjuvant therapy for these patients.

This type of reasoning, which assumes an asymmetric relationship between a newly formed group and a more numerous ancestral stock, provides an explanation for the observation first underlined by Muller in 1942 that incompatibilities between closely related species are very often asymmetric (C&O, p274).

The vector was prepared by PCR amplification of PL458 with two oligonucleotides that only excluded the sequence coding for PNP1 20 using the sense primer 5′ ATG GACAGCGATGACCGCGTG 3′ (with Met-MTGase start codon underlined) and the antisense primer 5′ GGA AGAATTCGTAATCATGGTCATAGCTG 3′ (where the first underlined codon is the complementary codon for the last aminoacid of LacZ1 8 fragment).

Using numerical simulations, advantages of the alternative architecture are first underlined.

Within the antisense oligo sequence, the first underlined sequence represents an EcoR I restriction site and the second is a Bbs I site.

Going through this statement in detail, it first underlines the point that Dolby hasn't just ported its 'standard' Dolby Vision profile onto Microsoft's consoles.

This, in turn, would first underline the importance of integrating elements of relapse prevention into inpatient treatment programs for AN patients as, e.g. education and skills training related to drawbacks and relapses, and would second underline the importance of relapse prevention interventions following inpatient treatment.

The start of the third underlined what a maddening player Murray can be.

The second, underlined by the attendance of Barack Obama, was to demonstrate the seriousness of America's commitment to defeating IS.

The first underlines the importance of lamin A/C as structural proteins in maintaining nuclear architecture, since their absence results in sensitivity to mechanical stress [8].

The Skids and XTC flexidisc given away with the first issue underlined the mass appeal of the new pop aesthetic.