Sentence examples for first part of the transcript from inspiring English sources

· Read the first part of the transcript here.

Examination of the fusion transcript was done with a forward primer in the first part of the transcript (F 5'CandCTGTTCTGaCGGTTCCA3') and a reverse primer in the other part (R 5'CAAAGTAGAATATAGTTGTCCAAAACACAA3'CAAAGTAGAATATAGTTGTCCAAAACACAA3

The fusion nature of this clone was confirmed by RT-PCR on cell line IMR-32 using a primer in the first part of the transcript on 2p13.3 and a primer in the other part of the transcript on 2p24.3.

Missed the first part of the quiz?

Make the first part of the turret.

Repeat the first part of the process.

The similarities of the expression patterns of PHYA, CRY1a and CRY2 genes in both LD and LL (Figure 4B and Figure 5B), namely high levels of expression in the second part of the day (ZT8-16) and very low transcript abundances during the night, could be potentially related to overlapping functions and/or cooperation in their physiological roles.

In the second part of the experiment, we performed a comparison of transcript levels between Od, Hz and two pools from the Pop-DG population, recently analyzed at transcriptomic level [ 17].

Here's the story: two of the best bloggers around, Dennis Cozzalio Sergio Leonee and the Infield Fly Rule) and Farran Smith Nehme (Self-Styled Siren), had a discussion via Skype about movies, their blogs, and themselves, and posted the transcript of the first part of it at the former site.

Repeat the second part of the knot.

DOI: http://dx.doi.org/10.7554/eLife.03913.018 In-depth analysis of s-traits from gene LOC_Os03g01360 revealed that the expression values of s-traits from the first part of LOC_Os03g01360 were positively correlated with two transcripts, LOC_Os03g01360.1 and LOC_Os03g01360.4, and negatively correlated with the other LOC_Os03g01360.2.