Sentence examples for famous serial from inspiring English sources

Mr. Slot also draws on other famous serial killers for inspiration: his play features three different killers.

His standing could be in jeopardy, though, if the crime novelist Patricia Cornwell ever succeeds in proving her conviction — argued at length and at great expense in her book Portrait of a Killer: Jack the Ripper— Case Closed — that the British painter Walter Sickert was in fact the famous serial killer.

But the carnage is only the grabber for what is actually a very tricky legal mystery, and Riley, who prosecuted "the most famous serial killer our city has ever seen" when he was a raw youth, doesn't really hit his stride until he walks down those mean corridors that lead to the courtroom.

There also are no dedicated sleep funds or famous serial sleep entrepreneurs to track.

But this year, Rabe will be checking into the "Hotel" to portray a famous serial killer.

Would you say you have a romantic attraction to some of these famous serial killers?

High-net-worth borrowers with so-called jumbo mortgages, or loans over $625,500, "are famous for serial refinancing," said Keith Gumbinger, a vice president of HSH.com, a financial publisher in Pompton Plains, N.J.

First, the 6His tag sequence in the 22 bp upstream homologous recombination region (5′CAGCCACCATCATCACCACCAC3′, 6His tag underlined) was redesigned (compared with 6His tag sequence in the famous pET serial vectors) to ensure the efficiency of recombination PCR.

It is the story of a dysfunctional American family: the middle-aged children of Travis Appaloosa (not his real name), the passé star of a once-famous TV serial called Joint Custody, also about a dysfunctional American family.

The most famous case of serial murder in the 19th century was that of Jack the Ripper, who killed at least five women in London in 1888.

In her latest, a fitness-machine repairman's dual fixations — on a famous Notting Hill serial killer, hanged half a century before, and on a young black model in thrall to a soothsayer — collide.