Sentence examples for extra sequence from inspiring English sources

An extra sequence "TAGTTGTTTTGCAACCTCTTTCTCTTTTTTTCCTTGTCCATTTCTCTTTCAGGTCGATGTTTGTTAAAGACACGAAGACGATTGACCTTTGCTCCTGTGCGTTATGCTGACAGG" was found in sequenced cDNA, which located in chromosome 9 from 63891277 to 63891165, the 11th exon of SlAGO10A genomic sequence (ch9: 63895090–63888840).

The purified protein contained the extra sequence GPH- at the N terminus.

Data suggest that the extra sequence has a crucial role in enzyme activation and structural stability.

This score penalizes bases missing from the CDS sequence without penalizing extra sequence that may have been added to the RNA-seq transcript model during the assembly process.

While a long nonrelated sequence at the 3′-end delayed but did not prevent establishment of the productive infectious cycle, a much shorter extra sequence at the 5′-end completely abrogated virus replication.

Multiple sequence alignments have shown that some bacterial γ-GTs, including that from Bacillus licheniformis (BlGT), possess an extra sequence at the C-terminal tail of the large subunit, whose role is unknown.

More complex mutations involved missing or extra sequences of DNA.

There are even hidden items around environments that unlock extra sequences in the next TV sequence.

The extra sequences used for intramitochondrial sorting of CYP11A1 apparently ensured predicted topology of hybrid molecules in yeast mitochondria.

Unlike most LIC vectors available commercially, our vectors will not translate unwanted extra sequences by engineering the N-terminal linker to anneal before the open reading frame, and the C-terminal linker to anneal as a His-tag.

Furthermore, our data reveal the possible location of the predicted helical stem formed by basepairing between the extra sequences in the 5′ and 3′ ends of the 17S rRNA.