Similar(60)
After that, each was carried to term in the uterus of still another dog — a step which, though it has no bearing on the dogs' genetic makeup, can affect such external traits as the waviness of fur and the up-or-down pointing of the ears.
He collects an engaging array of actors whose external traits — gender, skin color, accent, body type, attire, posture, tone of voice — seem to suggest a great deal more about them than the movie itself, than Scott himself, has any interest in.
It is possible that these external traits are linked to the chemical composition of the cactus, but it could also be that their power is purely symbolic.
And statutory safeguards could be afforded for sensitive external traits about whether a suspect has changed genders, for example, or had plastic surgery.
To do so I ask my students to participate in Harvard University's Project Implicit, which began simply focused on external traits of skin color and gender but which now "tests" participants for a variety of implicit assumptions.
When unambiguous, birds were sexed by external traits (blackcaps, great tits, blackbirds).
Heterozygous and wild-type Edardl-J specimens exhibit similar external traits and were genotyped through PCR amplification of a 306 bp fragment covering the point mutation (primers: 5' GTCTCAGCCCCACCGAGTTG and 3' GTGGGGAGGCAGGTGGTACA), followed by sequencing.
Brown lemurs have not received as much attention as ring-tailed lemurs, because of their cathemeral activity and relative lack of conspicuous external traits allowing quick individual recognition other than "male" or "female".
The summary profile (eigengene) for each module was then correlated with external traits.
Next, these modules can be correlated to external traits, for example disease stage, age, sex, etc.
Module eigengenes were subsequently matched to external traits as described before and corrected for multiple hypotheses testing.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com