Sentence examples for external cycle from inspiring English sources

At the first (external) cycle we tested whether the estimated fraction of positions under purifying selection depended on the choice of genomes included in the alignment.

Circadian clocks allow organisms to adapt to the predictable changes of the 24-hour day/night cycle by generating endogenous rhythms that can be entrained to the external cycle.

Colour changes extending over several hours are often entrained to external cycles.

In contrast to previous studies, this work proposes that external cycles can be detected in the autocorrelation dynamics rather than in the raw North Atlantic Oscillation index series.

The appropriate timing (phase) of circadian behavioral and physiological rhythms relative to external cycles is accomplished through entrainment of the central circadian clock to the light-dark cycle (17).

Instead, our studies clearly indicate that it is the altered phase relationship between the external light cycle and internal circadian timing that drives the aberrant physiology.

Rhythms in both SCN gene expression and corticosterone were significantly dampened in the 22.5 h LD housed mice, suggesting that the phase misalignment with the external LD cycle weakens the central oscillator.

In state-of-the-art technology, the CO2 is compressed to the transport pressure before it is liquefied by an external refrigeration cycle, using ammonia as the refrigerant.

The code allows simulation of key facilities of the external fuel cycle (fuel fabrication and reprocessing facilities, SNF storage, uranium, plutonium, neptunium, americium and curium stores, RW long-term storage sites), nuclear reactors, including RBMK-1000 rexisting existing and advanced VVER reactors (using different fuel types), and fast reactors (both existing and innovative).

And the lower one is from the next external orange cycle paint layer and painted with red lead (74%wt Pb).

Reverse transcription and an external amplification cycle were performed with 5 µl of RNA extract and primers EF101F TTCTCGTATGATACCCGCTGYTTTGA and HCVNS5Rnb TACCTGGTCATAGCCTCCGTGAAGGCTC in a final volume of 20 µl C. therm.