Sentence examples for extended templates from inspiring English sources

Exact(2)

Kozakaya et al. [98] solve the landmarking problem using multiple voting of extended templates.

RNAs (1 µM) transcribed from the extended templates were purified and hybridized to the biotinylated oligonucleotide (5' GAATTAAATGCCCGCCATGACCAG 3') (1 µM) by heating to 70°C for 3 mins and cooling to 25°C.

Similar(58)

hPol κ extended template-primers in the order M1dG dC > M1dG dG > M1dG dT ∼ M1dG dA, but neither hPol ι nor Rev1 extended M1dG-containing template-primers.

The SMART™ oligonucleotide which has an oligo(G) sequence at its 3′ end, base-pairs with the deoxycytidine stretch, creating an extended template.

Single nucleotide incorporation experiments indicate that hPol κ extended template-primers containing dC opposite M1dG approximately 10-fold more efficiently than template-primers containing other deoxynucleotides opposite the adduct when it is contained in the 3′-GXC-5′ sequence.

It is hypothesized that clinical lymph node relapse could be the direct consequence of a suboptimal PLND at the initial treatment or a progression outside the boundaries of the standard extended template.

Support for this hypothesis is provided by the observation that hPol κ is very inefficient at extending template-primers containing dC PdG termini (27).

This extends template stripping to high-melting-point solids, such as W, and transparent conductors, such as ITO, both of which are difficult to pattern with conventional methods.

Human Pol κ inserted dCMP opposite the exocyclic lesions less efficiently than hPol ι did, but hPol κ was able to extend template-primers containing dNMPs opposite the adducts.

The present results demonstrate that hPol κ, hPol ι, and Rev1 are able to insert deoxynucleotides opposite M1dG and that hPol κ is able to extend template-primers containing deoxynucleotides opposite the lesion.

This correlation output can provide significantly higher peak gain due to the use of the virtually extended signal template which consists of the original template and a "dirty template" from data detection results.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: