Sentence examples for expression was introduced from inspiring English sources

Framework for incorporating different geotechnical variabilities using rule-based uncertainty expression was introduced.

This expression was introduced in [6], and after that it has attracted significant attention (some of those results can be found in [7 11]).

Intermediate vector pC3.3 was constructed based on pC3.2 by means of the same mutation protocol mentioned above with primer set 5′CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTTCGAAGGCGGTAATACGGTTATCCACAG 3′ and 5′ AGCCATAGAGCCCACCGCA 3′, by which T7 terminator (underlined sequence) for prokaryotic expression was introduced into a site downstream BGH Poly(A) site.

In analogy to the term gene expression the term 'protein expression' was introduced by Wilkins and Gooley, 1997 [23] into the proteome definition: "In proteome projects, which aim to identify and characterize all proteins expressed by an organism or tissue, the identification of proteins is central".

This widespread, often subtle and customized, influence of miRNAs on mRNA expression was introduced by Bartel and Chen as the 'micromanager model' or 'tuning' of miRNA function [22].

TN-XXL gene expression was introduced into each of the α7-Ric3 and α4β2 cells via lentiviral transduction as described [21] and fluorescence activated cell sorted (FACS) for high levels of eCFP and Citrine cp174 fluorescence.

The representation, matching expression, is introduced, which represents the combination of fragments of translation examples.

Furthermore, a new analytical expression is introduced to evaluate the force constant corresponding to this kind of energy.

A simple algebraic expression is introduced to calculate the fundamental frequency with satisfactory accuracy for preliminary design purposes.

To address this issue, ES cell-derived neural precursors exhibiting neuron-specific enhanced green fluorescent protein (EGFP) expression were introduced into the developing brain.

In particular, the possibly infinite set of arguments is specified through the language recognized by a deterministic finite automaton while a suitable formalism, called attack expression, is introduced to describe the relation of attack between arguments.