Sentence examples for expression master from inspiring English sources

Real-time PCR analyses were carried out using the Applied Biosystems 7000 sequence detection system and the TaqMan gene expression master mix (Applied Biosystems, Foster City, CA).

Real-time PCR assays were performed in quadruplicate using TaqMan Gene Expression Master Mix (ABI), gene-specific TaqMan TAMRA probes (ABI) and an ABI 7000 sequence detection system.

About 2 µL of cDNA were amplified using the TaqMan® Gene Expression Master Mix and TaqMan® Gene Expression Assay for frataxin (Applied biosystems, catalog n°Hs00175940_m1) in a StepOne real-time PCR.

Quantitative RT-PCR was performed with Power SYBR-Green or Taqman Gene Expression Master Mix (Applied Biosystems) using a 7300 Real-Time PCR system (Applied Biosystems) following the manufacturer's protocols.

A 15 ul mixture was formulated with 7.5 ul of TaqMan Gene Expression Master Mix (Applied Biosystems), an appropriate volume of first strand cDNA, 3 pmol of forward and reverse primers, and 0.5 pmol TaqMan probe.

Quantitative RT-PCR for RUNX1 was carried out using Taqman gene expression master mix (Applied Biosystems) and custom-synthesized oligos of RUNX1-forward (GATTAGCTGAAGATCTCTGAAACGCT), RUNX1-reverse (GTACTTGTCATGTTCTCTGTTCTCTCA) and FAM-MGB labeled Taqman probe (CAGTGCAGAAAATTC).

Amplification of genomic DNA was performed on an ABI 7900HT Real-time qPCR instrument using Taqman Gene Expression Master Mix (Applied Biosystems).

One microgram of total RNA was converted to cDNA (Transcriptor High Fidelity cDNA Synthesis Kit, Roche) and HMOX1 expression was quantified using TaqMan Gene Expression Assay Hs00157965_m1 from ABI with TaqMan Gene Expression master mix.

TaqMan assays were used to quantify SHP-1 (Mm00469153_m1) expression using the TaqMan Gene Expression Master Mix (Applied Biosystems).

Amplification was performed on 20 to 300 ng of cDNA with Taqman gene expression Master Mix Life Technologiess).

Universal Expression Master Mix was used for all expression studies with TaqMan probes according to standard conditions (Applied Biosystems).