Sentence examples for expression is listed from inspiring English sources

Exact(4)

This expression is listed on Urban Dictionary.

The complete list of probes reporting differential expression is listed in supplementary Table S1.

The demographic distribution of the other variables according to LAT1 expression is listed in Table 2.

Gene expression is listed as cycle threshold value (Ct) consistent with RT-PCR-based data.

Similar(56)

For real-time PCR, primers used for gene expression are listed below: Dmp1, GGTGATTTGGCTGGGTC, TGTGGTCACTATTTGCCTGT; Gapdh, CCTCGTCCCGTAGACAAAATG, TCTCCACTTTGCCACTGCAA, Aqp4, TTTGGACCCGCAGTTAT, AAGGCGACGTTTGAGC; The mRNA expression level was normalized to housekeeping gene GAPDH.

The specific primers used for quantification of Hd3a, RFT1, OsMADS15, OsMADS14, Hd1, Ehd1, Ghd7, Ghd8, DEP1, FZP, LAX1, SP1 and RUBQ2 mRNA expression are listed in Additional file 1: Table S4.

All genes assayed for monoallelic expression are listed in Dataset S2.

The forty genes with the highest differential expression are listed in Table 1.

Primers used for detecting gene expression are listed in Table 1.

The genes showing increased expression in the Dysbindin knockdown cells, as well as in the NF-YB knockdown cells, are listed in Table 1A, while those showing decreased expression are listed in Table 1B.

Those genes that showed specific expression were listed in Additional file 6.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: