Sentence examples for expression is listed from inspiring English sources

This expression is listed on Urban Dictionary.

The complete list of probes reporting differential expression is listed in supplementary Table S1.

The demographic distribution of the other variables according to LAT1 expression is listed in Table 2.

Gene expression is listed as cycle threshold value (Ct) consistent with RT-PCR-based data.

For real-time PCR, primers used for gene expression are listed below: Dmp1, GGTGATTTGGCTGGGTC, TGTGGTCACTATTTGCCTGT; Gapdh, CCTCGTCCCGTAGACAAAATG, TCTCCACTTTGCCACTGCAA, Aqp4, TTTGGACCCGCAGTTAT, AAGGCGACGTTTGAGC; The mRNA expression level was normalized to housekeeping gene GAPDH.

The specific primers used for quantification of Hd3a, RFT1, OsMADS15, OsMADS14, Hd1, Ehd1, Ghd7, Ghd8, DEP1, FZP, LAX1, SP1 and RUBQ2 mRNA expression are listed in Additional file 1: Table S4.

All genes assayed for monoallelic expression are listed in Dataset S2.

The forty genes with the highest differential expression are listed in Table 1.

Primers used for detecting gene expression are listed in Table 1.

The genes showing increased expression in the Dysbindin knockdown cells, as well as in the NF-YB knockdown cells, are listed in Table 1A, while those showing decreased expression are listed in Table 1B.

Those genes that showed specific expression were listed in Additional file 6.