Sentence examples for expression is introduced from inspiring English sources
The representation, matching expression, is introduced, which represents the combination of fragments of translation examples.
Furthermore, a new analytical expression is introduced to evaluate the force constant corresponding to this kind of energy.
A simple algebraic expression is introduced to calculate the fundamental frequency with satisfactory accuracy for preliminary design purposes.
In particular, the possibly infinite set of arguments is specified through the language recognized by a deterministic finite automaton while a suitable formalism, called attack expression, is introduced to describe the relation of attack between arguments.
If the fracture conductivity is higher than the matrix one (fractures saturated with water of the same or higher conductivity), the first-order expression is introduced for the effective conductivity tensor.
The "+1" in the nondimensional temperature expression is introduced to ensure that the computing process does not touch the limit of 0 K.
To address this issue, ES cell-derived neural precursors exhibiting neuron-specific enhanced green fluorescent protein (EGFP) expression were introduced into the developing brain.
This expression was introduced in [6], and after that it has attracted significant attention (some of those results can be found in [7 11]).
In analogy to the term gene expression the term 'protein expression' was introduced by Wilkins and Gooley, 1997 [23] into the proteome definition: "In proteome projects, which aim to identify and characterize all proteins expressed by an organism or tissue, the identification of proteins is central".
Intermediate vector pC3.3 was constructed based on pC3.2 by means of the same mutation protocol mentioned above with primer set 5′CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGTTCGAAGGCGGTAATACGGTTATCCACAG 3′ and 5′ AGCCATAGAGCCCACCGCA 3′, by which T7 terminator (underlined sequence) for prokaryotic expression was introduced into a site downstream BGH Poly(A) site.
