Sentence examples for export errors from inspiring English sources

Exact(1)

Also to exclude possible export errors from Leco ChromaTOF software to cdf file format the height of given peak was compared with row chromatographic data.

Similar(59)

BAC-ends were sequenced on the ABI PRISM 3130 XL Genetic Analyzer Appliedd Biosystems, Hitachi) using pIndigoBAC5 sequencing primers: 3′- GGATGTGCTGCAAGGCGATTAAGTTGG 5′- CTCGTATGTTGTGTGGAATTGTGAGC Chromatograms were verified in Chromas Lite 2.01 for base-calling errors and exported as BAC-end sequences (BES) in the FASTA format.

A promising approach to estimate the natural trophic state for lakes is the use of models that predict the trophic state of a lake from nutrient loading (e.g., Vollenweider 1976; OECD 1982), however, it must be borne in mind that any empirical model involving nutrient export coefficients bears various methodological errors (Ryding and Rust 1989).

The job descriptions were typed verbatim into a word processor and saved as text files, compared with the original text to ensure no errors, prior to exporting to the RQDA package.

America's primary export, it appears, is trial and error, and the innovative knowledge attained in such a way.

One central concept in the development of eMZed was the integration of previously established algorithms into a single platform that minimizes error-prone import and export steps.

Numerical interview data will be exported into EpiInfo and checked for entry errors, logic and range.

Exported data are then systematically verified to detect errors.

Consistency and range checks were made and errors were corrected in Epidata before exporting to SPSS 11.5 for analysis.

The EpiTYPER software provides convenient solutions for data analysis and export, however,the Sequenom EpiTYPER has a 5% technical error rate [ 33].

On the other hand, we stress that the predictions contain apparent errors, as we predict obvious cytoplasmic proteins to have a T3SS export signal.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: