Sentence examples for experiments target from inspiring English sources

Our last experiments target the effect of the number of byzantine clients.

Fig. 1 Example of the experimental environment in all experiments (target was red in Experiment 4) from the participant's perspective.

Table 2 Nucleotide sequences of the primers used in the q-PCR experiments Target mRNA Target protein Forward primer Reverse primer NOSIII eNOS TGGCTTTCCCTTCCAGTTC AGAGGCGTTTTGCTCCTTC EDN1 ET-1 TGTGTCTACTTCTGCCACCTG TGGCTAGCACATTGGCATCTA ACTB Beta-actin AACTCCATCATGAAGTGTGACG GATCCACATCTGCTGGAAGG NOSIII/eNOS endothelial nitric oxide synthase, EDN1 preproendothelin-1, ET-1 endothelin-1.

For both fMRI experiments, target analyses evaluated the interactions between the two experimental factors.

Multiple neurons were recorded simultaneously in 13 experiments for monkey A, and in 6 experiments for monkey T. In these experiments target 1 was positioned so as to activate all response fields (simultaneous recordings were only carried out if the response fields overlapped substantially).

PL performed benchwork experiments, target list analyses and comparisons.

In order to validate the performance of the proposed method, three experiments: target-background separation, background clutter suppression and infrared small target detection, are performed over different clutter background with real infrared small targets in single-frame or sequence images.

Darren's paper on knockdown experiments targeting 59 TFs is out on ArXiv.

In two experiments targeting the botulinum neurotoxin serotype A metalloprotease light chain, hit rates of 32% and 18% were observed.

To assess this hypothesis, we designed four auditory discrimination experiments targeting pitch, non-vocal and vocal timbre, and loudness.

Initial experiments targeted the amphDIII gene, which encodes a GDP-D-mannose 4,6-dehydratase involved in biosynthesis of mycosamine.