Your English writing platform
Discover LudwigSuggestions(1)
Exact(2)
Last year, Hitachi began to experiment to extract rare earths from magnets in old computer hard drives, though the company said the project was not expected to go into operation until 2013.
Nasa's 2020 rover – essentially an upgrade of Curiosity – will carry an electrolysis experiment to extract oxygen from carbon dioxide in the Martian atmosphere.
Similar(58)
Since it measures the alterations of the nuclear magnetic resonance (NMR) signal in the presence of paramagnetic molecules, a customized program is usually needed in FC-DNP experiments to extract spectral information from the acquired NMR signals.
We performed three experiments to extract polarity shifting patterns: I: Shifting positive clues in bad comments II: Shifting negative clues in good comments III: Shifting between positive clues and negative clues.
There have been experiments to extract uranium from sea water, but the yield has been low due to the carbonate present in the water.
The templates ti can be generated on a large scale and automatically since ETA relies on ET rather than experiments to extract putative determinants of a protein's function.
The annotated PhenoCHF corpus was subsequently used in experiments to extract and categorise mentions of concepts relating to phenotypes automatically.
However, researchers have encountered obstacles in the AMPs designing process as experiments to extract AMPs from protein sequences are costly and require a long set-up time.
The second sensory experiment aims to extract normalized tactile and visual sensory descriptors characterizing human perception on the concerned fabric samples.
As indicated in Section 2.2.1, the first part of the experiment was to extract features of concern.
A redundant 3' PCR primer based on residues 24 31 of ω-HXTX-Hv1a (ω-HV1 5' RTTNCCRTTYTCRTTYTCYTTRAA 3') was used in conjunction with a 5' universal adaptor primer in a 5' RACE experiment designed to extract information about the upstream region of the ω-HXTX-Hv1a transcript (EchoAP1: 5' CACCCCTAATACGACTCACTATAGG 3').
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com