Sentence examples for exhibits variation between from inspiring English sources

Nematode development is invariant from one specimen to the next, whereas in mammals, aspects of development are probabilistic, and development exhibits variation between even genetically identical individuals.

In order for transgenerational plasticity to itself evolve, it must be heritable and exhibit variation between genotypes.

The primer pair (forward 5′ TGTAAAACGACGGCCAGTGAAGAAGATGACACTAGGGACGAGGAAG 3′ and reverse 5′ GTTCTATGTGAGAACATGGGAAGAAACATGAC 3′ with fluorescently labeled 5′ 6FAM-TGTAAAACGACGGCCAGT 3′) exhibited variation between 'Elyana' and 'Mara des Bois' and segregation in the fifteen progeny tested.

Medaka fishes of genus Oryzias provide a good system for investigations into the genetic architecture underlying courtship traits because sexually dimorphic traits, including modified median fins, exhibit variation between closely related species (Iwamatsu 2006).

While the organization of these genes exhibits substantial variation between species, one common theme is that, in almost every case, there is at least one variable region with a highly diverse CDR3 region and often much less diversity elsewhere in the binding site.

The number of genes and unique transcripts inside the selected inflamed regions were both higher and exhibited lower variation between replicates for the automated libraries compared to the manual libraries (Supplementary Figure 1).

Chimpanzee (Pan troglodytes) cultures exhibit considerable variation between communities [1].

The LOS biosynthesis region exhibited significant variation between the strains examined.

From a demographic point of view, some demographic traits exhibit significant variation between coastal and montane regions.

However, the inclusion pathology exhibited greater variation between HdhQ150/Q150 mice than in R6/2 and we did not find a reduction in the number of secretory vesicles in knock-in β-cells.

This is in spite of the fact that a) taxa diversity appeared much more limited in the lab environment and b) field dumps exhibited considerable variation between samples (Figure 2 and 4D).