Sentence examples for example would be suitable from inspiring English sources
The Muslim Council of Britain, for example, would be suitable for the former, if not the latter.
Latent Growth Modelling for example would be suitable in this regard, but requires longitudinal data which is not at our disposal.
(For example, primer GAGAGAGCGGCCGCGAGAGA would be suitable for the biotin-labeled poly dT -oligonucleotide used in our work; see above).
We have used data on breast cancer incidence and EtO exposure, which exhibit attenuation, to illustrate the two-piece spline model; however, as noted above, there are many other examples where this approach would be suitable.
An example is the fingerprint scanner for door handles, which would be suitable for someone with Parkinson's disease who may struggle with keys, he said.
The council could, for example, continue to investigate sites to see if the geology would be suitable for a waste store.
Here's a few examples of the types of songs you would write to a certain person: Love songs would be suitable for: Boyfriend Girlfriend Crush Possibly a relative (in this case, the love song might be about your sibling/parent/child(ren), or it could be a song about something/someone the relative loves).. Funny songs would be suitable for: Child Friend Relative Teacher.
