Sentence examples for example with sequence from inspiring English sources

Exact(2)

Indeed, network data are very erroneous when compared, for example, with sequence data.

They provide numerous tools and applications for genetic data retrieval and analysis for example with Sequence Retrieval System SRS [ 52] and BioPerl [ 53].

Similar(58)

In summarizing these results, while we found some striking differences, for example with coding sequence length in brain, we note that this was not replicated in lymphocytes.

For example, with the sequence set shown in Figure 2, the alignment score of the – biologically more meaningful – anchored alignment was > 13% below the non-anchored alignment (see Table 1).

For example, with a sequencing base error rate of 1bp per 100 bp sequenced [ 9], k erroneous k-mers will be produced, being k equal to k-mers size.

It seems to me that an example with two sequences is not ideal to illustrate the distinction between the two types of approach: were a third sequence added that was similar to 1&2 such that all pairs of the triad were significantly similar, I presume that common ancestry would once again be supported.

Figure 9 b gives an example with three sequences and an occurrence of the motif (from Fig. 9 a) in each of them.

For example, with 0.1× sequencing depth, they reported an increase in imputation accuracy from approximately 0.05 to more than 0.70 when the reference panel was used.

The program takes as input a character matrix in a NEXUS file format, for example with DNA sequences, and among the output it also generates the Nexus formatted phylogram that corresponds to the user specified parameterization.

For example, with 100,000 sequences, we need to compute approximately 5 billion distances to construct a complete distance matrix as needed by standard implementations of Neighbor-Joining [ 11] or UPGMA [ 12].

For example, one probe with sequence TCGGCCTCCCAAAGTGCTGGGATTA, which was designed to interrogate a non-repetitive sequence on chromosome 19, mapped to 114,450 locations in the genome.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: