Sentence examples for examination of fusion from inspiring English sources

Exact(3)

Examination of fusion proteins with green fluorescent protein revealed that the N-terminal portion was important for localization to the nucleoli of tobacco and onion cells.

Our use of ideal observer analysis, a popular technique from the vision sciences, provides not only a standard for testing fusion in direct relation to the visual system but also allows for comparable examination of fusion across its associated problem space of application.

Gross examination of fusion masses was performed.

Similar(57)

Examination of fusions between GalE domains and thioredoxin (TrxA) showed that the N-terminus of GalE induces SsrA tagging within the fused C-terminal TrxA domain.

This paper provides a more discerning examination of image fusion, assessing its direct impact on the human visual system by applying a technique commonly used in visual perception research: ideal observer analysis.

Examination of the fusion transcript was done with a forward primer in the first part of the transcript (F 5'CandCTGTTCTGaCGGTTCCA3') and a reverse primer in the other part (R 5'CAAAGTAGAATATAGTTGTCCAAAACACAA3'CAAAGTAGAATATAGTTGTCCAAAACACAA3

Examination of GalE-thioredoxin (TrxA) fusion proteins showed that the GalE C-terminal domain is no longer tagged when fused to an N-terminal TrxA domain.

Pathological examination further revealed a lack of fusion in the urogenital fold in treated fetuses, the damaged seminiferous tubules, and the injured Leydig cell ultrastructure.

Fracture surface examination and μCT scans revealed lack of fusion defects, disbonded regions, and random/isolated porosity for the as-deposited samples tested in this study.

Examination of green fluorescent protein fusions established that IDI1 is mainly located in the plastids, whereas IDI2 is in the mitochondria.

Though the effects of disrupting PE biosynthesis in yeast are likely too pleiotropic to allow examination of its effects on vacuole fusion in vivo, PE is required for the fusion of mitotic Golgi membranes (Pécheur et al., 2002).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: