Sentence examples similar to evidences of origin from inspiring English sources

The Berchtesgadener Anzeiger newspaper reported that experts swiftly confirmed that the gold bullion was not from the Third Reich but found "no concrete evidence of origin or ownership".

Strong evidence of origin based hiring discrimination has been detected in various developed countries 1 such as Australia (Riach and Rich, 1991), the USA (Bertrand and Mullainathan, 2004) and France (Duguet et al., 2010, 2011).

(Maybe that's why they called it "shredding": it destroyed evidence of origins).

By comparing the locations of these rearrangement breakpoints with extant S. cerevisiae replication origins, we can ask if there is any evidence of origins correlating with the production or resolution of genomic breaks over evolutionary time.

Having identified the possible origins of LSGs by analysing the genomic context of the LSGs within the Arabidopsis thaliana genome (i.e. overlapping genes, duplicates and TE exaptation), we next tested for any evidence of origins of LSGs derived from non-coding DNA sequence from non-Brassicaceae species.

These facts we consider as evidences of solar origin of the increased pre-flare ACS count rate.

Our results provide evidence for origin of eukaryotic metacaspases from bacteria.

Some signatures such as 5'TGTGGTTTAATTCGAAGCAACGCGAAGAA 3' were shared by all the Bacillus spp. except B. subtilis, B. pumilus and B. sphaericus, providing "evidences" of common origins.

We found the strongest evidence for parent-of-origin effects on chromosomes 4, 20 and 15, implicating sites where imprinted loci related to autism may reside.

In conclusion, this article presents novel evidence for parent-of-origin effects in SLI.

We found significant evidence for parent-of-origin effects in SLI.