Sentence examples for evaluated using primers from inspiring English sources

Signals on genes were evaluated using primers at the promoter (P), and end (E) of the coding sequence.

The targeting specificity and efficiency following individual siRNA knockdowns was evaluated using primers and RT (reverse transcription)–PCR analysis, as described previously [ 2, 45].

Specific cleavage of mtDNA was evaluated using primers flanking the cleavage sites (primers for Cox1 and Cox3; please refer to Figure 1(b) and Table 2 for detailed information on primers and annealing loci).

The sites of the possible primers were selected visually and evaluated using Primer test option of Primer Express software (Applied Biosystems®, USA).

The new primers were evaluated using primer design software (oligoAnalyzer 3.1, Integrated DNA technologies, Inc .. Primer IS 1311 M56 [ 31] was modified to obtain Primer IS 1311/auF by inserting K to cater for degeneracy observed on the 8th base in some GenBank sequences.

MiRNAs' levels were evaluated using specific primers (microRNA LNA™ PCR primer set, Exiqon, Vedbaek, Denmark) according to the manufacturer's recommendations.

The putative amplicons that could be generated by the yaiO and uidA primers were evaluated using the Primer-BLAST tool [ 35], restricting the target templates to Enterobacteriaceae.

BCL2L1 and CCND1 expression was evaluated using the primers TGGAACTCTATGGGAACAATGCA (forward)/TCAGGAACCAGCGGTTGAAG (reverse) and TCGTGGCCTCTAAGATGAAGGA (forward)/GATGGAGCCGTCGGTGTAGAT (reverse), respectively.

The splice variant of XBP1 was evaluated using the primers and conditions as described in the Supplementary Data.

The efficiency of annealing of the oligonucleotide PCR primer sequences (listed in Additional file 13: Table S6) was evaluated using the Primer 5.0 program.

The array was evaluated using multiple primer pairs.